retrovirus vector pretrox  (TaKaRa)

Journal: Cell reports

Article Title: BACH1 inhibits senescence, obesity, and short lifespan by ferroptotic FGF21 secretion.

doi: 10.1016/j.celrep.2024.114403

Figure Lengend Snippet: Figure 1. The secretion from ferroptotic fibroblasts by BACH1 re-expression activates the proliferation and suppresses the expression of SASP in other cells (A–H) The control or Tet-ON BACH1 genes were introduced into Bach1/ iMEFs using retrovirus vectors. 2-ME was removed by culture medium exchange. The culture supernatant from the iMEFs (control: control supernatant, Tet-ON BACH1: ferroptotic supernatant) treated with Dox for 48 h was transferred into Hepa1 cells. The Hepa1 cells were analyzed after treatment with the control or ferroptotic supernatant for 2 (G and H), 3 (F; Figures 2B–2D, 2G, and 2H), or 4 (B–E; Figure 2A) days. (A) Experimental design. (B) GO analysis of the Hepa1 cells. (C) Gene set enrichment analysis of the gene sets related to cell cycle and cytokine expression in the Hepa1 cells. (D) Heatmap displaying the RNA-seq results (counts per million mapped reads) of arbitrarily selected p53 signaling pathway-related genes (KEGG pathway, hsa04115) in the Hepa1 cells. The p values and log2FC (fold change) were calculated using differential expression analysis on edgeR. Cont.: control supernatant, Ferr.: ferroptotic supernatant.

Article Snippet: To overexpress the mouse FGF21 protein using the Tet-ON system, retrovirus particles were prepared by transfecting the retrovirus vector pRetroX-Tight-Pur (Takara Bio), into which the coding region of the mouse Fgf21 gene had been inserted into the multi-cloning site, into Plat-E cells using FuGENE HD (E2311, Promega).

Techniques: Expressing, Control, RNA Sequencing, Quantitative Proteomics

Journal: Cell reports

Article Title: BACH1 inhibits senescence, obesity, and short lifespan by ferroptotic FGF21 secretion.

doi: 10.1016/j.celrep.2024.114403

Figure Lengend Snippet: Figure 2. The secretion from ferroptotic fibroblasts by BACH1 re-expression suppresses senescence in other cells (A–D, G, and H) The control or Tet-ON BACH1 genes were introduced into Bach1/ iMEFs using retrovirus vectors, and Hepa1 cells were treated with the culture supernatant from the iMEFs as in Figure 1A.

Article Snippet: To overexpress the mouse FGF21 protein using the Tet-ON system, retrovirus particles were prepared by transfecting the retrovirus vector pRetroX-Tight-Pur (Takara Bio), into which the coding region of the mouse Fgf21 gene had been inserted into the multi-cloning site, into Plat-E cells using FuGENE HD (E2311, Promega).

Techniques: Expressing, Control

Journal: Cancer Science

Article Title: Xenotransplantation elicits salient tumorigenicity of adult T‐cell leukemia‐derived cells via aberrant AKT activation

doi: 10.1111/cas.12921

Figure Lengend Snippet: Correlation between the tumorigenicity and protein kinase B (AKT) activation of ST 1 cells. (a) Western blot showing the exogenously expressed constitutively active form of AKT ( CA ‐ AKT ). Cells were first transduced with pR etroX‐Tet‐On Advanced retrovirus vector and then with control pR etroX‐Tight‐Pur ( pT ight) or a CA ‐ AKT coding retrovirus vector. The cells were cultured with (+) or without (−) doxycycline (Dox) and analyzed by Western blot. The immunoblot was probed with an antibody to S473‐phosphorylated AKT ( pAKT ) or total AKT . Exogenously expressed CA ‐ AKT (Exo) and endogenous AKT (Endo) are indicated. (b) Western blot analysis of the developed tumors. Control ST 1 cells (No) or the retrovirus‐transduced cells described in (a) were injected into NOG mice, and the developed tumors were analyzed by Western blot. The blot probed with an anti‐hemagglutinin antibody ( HA ) showed the expression of CA ‐ AKT . (c) Tumor growth of control ( pT ight) or CA ‐ AKT vector‐transduced ST 1 cells. Results from six injection sites were averaged. * P < 0.05. (d) Tumor growth by ST 1‐N6 cells in NOG mice treated with the AKT inhibitor MK ‐2206 or control vehicle (30% Captisol). Data shown are representative of two independent experiments. * P < 0.05.

Article Snippet: To construct an expression vector for HA‐tagged CA‐AKT, the insert sequence of pLNCX‐Myr‐HA‐Akt (Addgene) was amplified using KOD FX polymerase (Toyobo, Osaka, Japan) following the manufacturer's recommendation, with primers 5′‐CTGAATTCCACCATGGGGTCTTCAAAATCTAAAC‐3′ and 5′‐CTGAATTCTCAGGCCGTGCCGCTGGCCGAGT‐3′ and subcloned into the Eco RI site of the pRetroX‐Tight‐Pur retrovirus vector (Clontech, Palo Alto, CA, USA) using a ligation kit (TaKaRa Bio, Ohtsu, Japan).

Techniques: Activation Assay, Western Blot, Transduction, Plasmid Preparation, Cell Culture, Injection, Expressing